Amino acid replacement R313P. This change is equivalent to a R284P change in the orthologous human OGT gene, a variant associated with intellectual disability.
CCCGCAATAGAACTGCAACCAAACTTTCCGGAC
Seven nucleotide changes affecting five codons results in a R313P amino acid change (AGG to CCC in R313 codon). The other changes are silent substitutions. Analogous mutation in human Hsap/OGT implicated in intellectual disability, X-linked.
sxcR313P has abnormal learning | dominant | adult stage | light conditional phenotype, suppressible by OgaKO/Oga[+]
sxcR313P has abnormal learning | dominant | adult stage | light conditional phenotype, suppressible by Oga[+]/OgaD133N