Amino acid replacement A348T. This change is equivalent to a A319T change in the orthologous human OGT gene, a variant associated with intellectual disability.
GAAGGAGGCCGAGGACTGCTATAACACTACC
Six nucleotide changes affecting six codons results in a A348T amino acid change (GCA to ACC in A348 codon). The other changes are silent substitutions. Analogous mutation in human Hsap/OGT implicated in intellectual disability, X-linked.
sxcA348T has abnormal learning | recessive | adult stage | light conditional phenotype, suppressible by OgaKO/OgaKO
sxcA348T has abnormal learning | recessive | adult stage | light conditional phenotype, suppressible by OgaD133N/OgaD133N