A TI{KozakGAL4} DNA cassette has been inserted into Pex16, replacing the coding sequence (coordinates of deleted sequence are 3L:20777041..20778206 , release 6 genome). This results in a simultaneous knock-out of Pex16 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Pex16 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: ATAAAAATAATGAGGTGTTTCGG and TAGAGCGTTAGTATTCCCCTAGG.
abnormal size | adult stage (with Pex161)
bang sensitive (with Pex161)
partially lethal (with Pex161)
short lived (with Pex161)
axon | adult stage (with Pex161)
Pex161/Pex16CR70194-KO-kG4 has short lived phenotype, non-enhanceable by Hsap\PEX16R176term.UAS.GFP
Pex161/Pex16CR70194-KO-kG4 has decreased rate of adult locomotory behavior phenotype, suppressible | partially by Hsap\PEX16UAS.GFP
Pex161/Pex16CR70194-KO-kG4 has decreased rate of adult locomotory behavior phenotype, suppressible | partially by Hsap\PEX16F332del.UAS.GFP
Pex161/Pex16CR70194-KO-kG4 has increased mortality during development phenotype, suppressible by Hsap\PEX16UAS.GFP
Pex161/Pex16CR70194-KO-kG4 has increased mortality during development phenotype, suppressible by Hsap\PEX16F332del.UAS.GFP
Pex161/Pex16CR70194-KO-kG4 has short lived phenotype, suppressible | partially by Hsap\PEX16UAS.GFP
Pex161/Pex16CR70194-KO-kG4 has short lived phenotype, suppressible | partially by Hsap\PEX16F332del.UAS.GFP
Pex161/Pex16CR70194-KO-kG4 has bang sensitive phenotype, suppressible by Hsap\PEX16UAS.GFP
Pex161/Pex16CR70194-KO-kG4 has bang sensitive phenotype, suppressible by Hsap\PEX16F332del.UAS.GFP
Pex161/Pex16CR70194-KO-kG4 has partially lethal phenotype, non-suppressible by Hsap\PEX16R176term.UAS.GFP
Pex161/Pex16CR70194-KO-kG4 has short lived phenotype, non-suppressible by Hsap\PEX16R176term.UAS.GFP
Pex161/Pex16CR70194-KO-kG4 has bang sensitive phenotype, non-suppressible by Hsap\PEX16R176term.UAS.GFP
Pex161/Pex16CR70194-KO-kG4 has decreased rate of adult locomotory behavior phenotype, non-suppressible by Hsap\PEX16R176term.UAS.GFP