A TI{KozakGAL4} DNA cassette has been inserted into Pex2, replacing the coding sequence (coordinates of deleted sequence are 3L:8339134..8340154 , release 6 genome). This results in a simultaneous knock-out of Pex2 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Pex2 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTTGTTTATATTCTTGCCTTTGG and GGTTCTGCGTGTCCTGAGTCGGG.
abnormal size | adult stage (with Pex22)
bang sensitive | progressive (with Pex22)
partially lethal (with Pex22)
short lived (with Pex21)
short lived (with Pex22)
short lived (with Pex2HP35039)
axon | adult stage (with Pex22)
Pex22/Pex2CR70193-KO-kG4 has decreased rate of adult locomotory behavior | progressive phenotype, non-enhanceable by Hsap\PEX2C247R.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has decreased rate of adult locomotory behavior | progressive phenotype, non-enhanceable by Hsap\PEX2W223term.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has decreased rate of adult locomotory behavior | progressive phenotype, non-enhanceable by Hsap\PEX2R119term.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has increased mortality during development phenotype, suppressible by Hsap\PEX2UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has increased mortality during development phenotype, suppressible by Hsap\PEX2E55K.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has short lived phenotype, suppressible | partially by Hsap\PEX2UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has bang sensitive | progressive phenotype, suppressible | partially by Hsap\PEX2UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has bang sensitive | progressive phenotype, suppressible | partially by Hsap\PEX2W223term.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has bang sensitive | progressive phenotype, suppressible | partially by Hsap\PEX2E55K.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has decreased rate of adult locomotory behavior | progressive phenotype, suppressible | partially by Hsap\PEX2UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has decreased rate of adult locomotory behavior | progressive phenotype, suppressible | partially by Hsap\PEX2E55K.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has abnormal neuroanatomy | adult stage phenotype, suppressible by Hsap\PEX2UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has abnormal neuroanatomy | adult stage phenotype, suppressible | partially by Hsap\PEX2E55K.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has abnormal neuroanatomy | adult stage phenotype, suppressible | partially by Hsap\PEX2C247R.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has abnormal size | adult stage phenotype, suppressible by Hsap\PEX2UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has abnormal size | adult stage phenotype, suppressible | partially by Hsap\PEX2E55K.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has abnormal size | adult stage phenotype, suppressible | partially by Hsap\PEX2C247R.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has partially lethal phenotype, non-suppressible by Hsap\PEX2C247R.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has partially lethal phenotype, non-suppressible by Hsap\PEX2W223term.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has decreased rate of adult locomotory behavior | progressive phenotype, non-suppressible by Hsap\PEX2R119term.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has decreased rate of adult locomotory behavior | progressive phenotype, non-suppressible by Hsap\PEX2C247R.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has partially lethal phenotype, non-suppressible by Hsap\PEX2R119term.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has short lived phenotype, non-suppressible by Hsap\PEX2E55K.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has short lived phenotype, non-suppressible by Hsap\PEX2R119term.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has short lived phenotype, non-suppressible by Hsap\PEX2C247R.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has short lived phenotype, non-suppressible by Hsap\PEX2W223term.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has bang sensitive | progressive phenotype, non-suppressible by Hsap\PEX2R119term.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has bang sensitive | progressive phenotype, non-suppressible by Hsap\PEX2C247R.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has decreased rate of adult locomotory behavior | progressive phenotype, non-suppressible by Hsap\PEX2W223term.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has adult motor neuron phenotype, suppressible by Hsap\PEX2UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has axon | adult stage phenotype, suppressible by Hsap\PEX2UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has adult motor neuron phenotype, suppressible | partially by Hsap\PEX2E55K.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has axon | adult stage phenotype, suppressible | partially by Hsap\PEX2E55K.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has adult motor neuron phenotype, suppressible | partially by Hsap\PEX2C247R.UAS.GFP
Pex22/Pex2CR70193-KO-kG4 has axon | adult stage phenotype, suppressible | partially by Hsap\PEX2C247R.UAS.GFP