A TI{KozakGAL4} DNA cassette has been inserted into whip, replacing the coding sequence (coordinates of deleted sequence are 2R:8362457..8363056 , release 6 genome). This results in a simultaneous knock-out of whip plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of whip (predicted to gene trap all annotated transcripts of the gene). The insertion is also within pdm3 and is not predicted to gene trap this gene. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CAGAAGAAGCTAGCGAGAACTGG and TAAAATGAGCGTGGAGTAATTGG. The PCR check gave the expected-sized band for the right flank and multiple weak bands for the left flank. The right insertion site was verified by sequencing.