A TI{CRIMIC.TG4.1} DNA cassette has been inserted into cindr, in a coding intron, and is predicted to gene trap 2/10 of the annotated transcripts of the gene. In addition, the coding exons of cindr downstream of the inserted gene trap cassette have been deleted (this affects all transcripts). The TI{CRIMIC.TG4.1} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target cindr : one targeted to a coding intron (ATTGGCAGGCACTTCAGTGTTGG) and the other to a non-coding exon in the 3' UTR (TATTCTGTACAGGCGGGTCTGGG).