loss of function allele
Three copies of the Tag:HA tag and a loxP site replace N-terminal coding sequence of the cic-L isoform.
Three copies of the Tag:HA tag replace coding sequence spanning from codons 117 to 751 of endogenous cic. Removes most of the cic-L N-terminal ('L'/long corresponds to isoform D).
GTGATCGAGGCCTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCGGCTCGCGATAGATCTCAGATAACTTCGTATAATGTATGCTATACGAAGTTATATAGATCTCAGCGGCCGCGGTACC
Three copies of the Tag:HA tag and a loxP site replace cic-RD and cic-RG
N-terminal coding sequences.
female sterile
partially lethal
egg chamber
cic8 is rescued by cicL.NTer.Tag:HA