A TI{KozakGAL4} DNA cassette has been inserted into PolA2, replacing the coding sequence (coordinates of deleted sequence are 3R:27239260..27241137 , release 6 genome). This results in a simultaneous knock-out of PolA2 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of PolA2 (predicted to gene trap all annotated transcripts of the gene). The upstream end of the deletion associated with the insertion is 175 bp from the annotated TSS of the CG31064 gene and the downstream end of the deletion is 130 bp upstream of the annotated TSS of the CG17991 gene; the deletion may affect the expression of either of these genes. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AAAATTAAACGCCCAACGAAAGG and TGATGATAAGGAAAGGATAGTGG.