A TI{KozakGAL4} DNA cassette has been inserted into Rbbp5, replacing the coding sequence (coordinates of deleted sequence are 3L:20346102..20347896 , release 6 genome). The translation start codon of the Rbbp5 gene is mutated in the homology donor so that the coding exon upstream of the insertion will not be translated. This results in a simultaneous knock-out of Rbbp5 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Rbbp5 (predicted to gene trap all annotated transcripts of the gene). The upstream end of the deletion associated with the insertion is 459 bp from the annotated TSS of the eRF1 gene on the opposite strand and may affect its expression. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AAAATGAATTTGGAGCTACTAGG and TTATTTCTTGGTACGTCCGGCGG.