A TI{CRIMIC.TG4.0} DNA cassette has been inserted into Zip102B, in a coding intron, and is predicted to gene trap a subset of the annotated transcripts of the gene. The insertion is in the coding intron of 2 transcript isoforms of Zip102B and is predicted to be a GAL4 reporter for them, but not for the other two isoforms in which the insertion is in an intron of the 5' UTR. The coding sequences of Zip102B downstream of the Trojan-Gal4 in all annotated transcripts are deleted. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Zip102B : one targeted to a coding intron (TACTTAATAAATGTCATTAAAGG) and the other to a non-coding exon in the 3' UTR (TCACAATACATTCTCGTATAAGG).