Contains two deletions (6bp and 19bp) within the Rtnl1 coding sequence, plus an inversion of the sequence between the two deletions. This inverts the sequence encoding the first intramembrane domain and deletes some of the sequence encoding the second intramembrane domain, leaving only the C-terminal half of the domain potentially able to be translated from an in-frame AUG codon.
ATGACGCCGAACTTGATCGAATCGATGATATCCTCAACAAGAAACAGACGCCTCAGCTCGGAGATGAAGCCATTGATATGTGCCACAGCCACGCCGGCAATGTTCTGTACCTTTTCGTGCGACAGCGTCAGATCCAGCTCCAGGTAATCCCTGATTTCGTAAGGAGTTACGTTAGTTAAACTTTTTTTTTTGTTGGGAGACATCAGTCTACAATACTCACTTAAAGGGGTGACCCTCGTTTGTCTTTTGCACGGCCTGTGTCACAGATTTGTAGATTCTGAAGGCGACGGTGCCGAAGAGGGTTAGGAGCGACAAGTAGGCGAACACGCTGATCACCGAGAAGCTGGAGATGGCCGCCAGTGTGATCAGGCCAGCGCCGAAGACAATGCCGGATTTCTTCACATCGCGCCA
Contains two deletions (6bp and 19bp) within the Rtnl1 coding sequence flanking an inversion of the sequence between the two deletions.
Rtnl118 has type I bouton | larval stage phenotype, suppressible by StimUAS.mCherry/Scer\GAL4GMR94G06
Rtnl118 is rescued by Rtnl1UAS.Tag:HA/Scer\GAL4Toll-6-D42
Rtnl118 is rescued by Rtnl1UAS.Tag:HA/Scer\GAL4GMR94G06
Rtnl118/Rtnl11.W is not rescued by Scer\GAL4Toll-6-D42/Rtnl1UAS.EGFP