A TI{CRIMIC.TG4.0} DNA cassette has been inserted into Bug22, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of Bug22 downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Bug22 : one targeted to a coding intron (GTCATCGAGAACCTGATTAGGGG) and the other to a non-coding exon in the 3' UTR (ATCGTCGACTCCGTCTGGTTAGG). The 3' end of the deletion associated with the insertion extends to within 34 bp from the annotated 3' end of the CG5188 gene and may affect proper mRNA 3' end formation.