A TI{CRIMIC.TG4.0} DNA cassette has been inserted into Spg7, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of Spg7 downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Spg7 : one targeted to a coding intron (CAGCTGCATCACCTACAGAGAGG) and the other to a non-coding exon in the 3' UTR (TGAGTTGGACCCATGGCCTCAGG). The PCR check of the insertion gave no band for the left flank and the expected sized product for the right flank. The insertion junction of the right flank was verified by sequencing.