A TI{KozakGAL4} DNA cassette has been inserted into CG11076, replacing the coding sequence (coordinates of deleted sequence are 4:1029931..1030967 , release 6 genome). This results in a simultaneous knock-out of CG11076 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG11076 (predicted to gene trap to trap only the CG11076-RA transcript isoform, but delete all of the coding sequences of all three annotated isoforms). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TAAAATCTAATAGTTTATCTAGG and TACTTCGTCCAGGTCATTAGCGG.