A TI{KozakGAL4} DNA cassette has been inserted into thoc5, replacing the coding sequence (coordinates of deleted sequence are 2R:23954100..23956333 , release 6 genome). This results in a simultaneous knock-out of thoc5 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of thoc5 (predicted to gene trap all annotated transcripts of the gene). The 5' end of the deletion associated with the insertion is 52 bp from the 5' end of CG3803 and may affect its expression. The 3' end of the deletion associated with the insertion is 2 bp from the 3' end of CG16787 and may affect the proper 3' end formation of its transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTAACAAAACTGATATAATGTGG and TACAACACAATGCGCCAATGCGG.