A TI{CRIMIC.TG4.1} DNA cassette has been inserted into CG8916, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of CG8916 downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.1} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target CG8916 : one targeted to a coding intron (GTTAATATAGCCATCTAAGGGGG) and the other to a non-coding exon in the 3' UTR (TTTGAATGCATCCTACGTGGGGG).