A TI{CRIMIC.TG4.0} DNA cassette has been inserted into Pld3, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of Pld3 downstream of the inserted gene trap cassette have been deleted. The 3' end of the deletion associated with the insertion extends to within 36 bp from the annotated 3' end of the Nbr gene and may affect its proper 3' end formation. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Pld3 : one targeted to a coding intron (CGTGGTCGCGGCTGTAGTAAAGG) and the other to a non-coding exon in the 3' UTR (AGTTAAAATAACATTGGCATCGG).