A TI{KozakGAL4} DNA cassette has been inserted into Dbp21E2, replacing most of the coding sequence (coordinates of deleted sequence are 2L:811596..813292 , release 6 genome); the 3' end of the deletion is 17 bp upstream of the stop codon. This results in a simultaneous knock-out of Dbp21E2 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Dbp21E2 (predicted to gene trap all annotated transcripts of the gene). The 5' end of the deletion associated with the insertion is 65 bp downstream of the 3' end of the Nnf1b gene and may affect the proper 3' end formation of its transcripts. The 3' end of the deletion associated with the insertion is 22 bp downstream of the 3' end of the Saf6 gene and may affect the proper 3' end formation of its transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CGTGTGCACAGCTGACTTGCCGG and ACTAAATGGACATACGCCTCAGG.