A TI{KozakGAL4} DNA cassette has been inserted into Ykt6, replacing the entire coding sequence. This results in a simultaneous knock-out of Ykt6 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Ykt6. The sgRNA sequences used to target the gene were: GGCTGCCAAGACTGGGTCTGCGG and GAGAGGATTAGCGTGTGGTGGGG.