A TI{CRIMIC.TG4.0} DNA cassette has been inserted into PTPMT1, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, almost all of the two coding exons of PTPMT1 downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target PTPMT1 : one targeted to a coding intron (ATGAGCTGAGCGGTTAAACAAGG) and the other to a non-coding exon in the 3' UTR (CCAAACAATGGGATGCCCTCCGG). The 3' end of the deletion associated with the insertion extends to within 38 bp from the annotated 3' end of the SdhD gene and may affect its proper 3' end formation.