A TI{KozakGAL4} DNA cassette has been inserted into Ski6, replacing the entire coding sequence (coordinates of deleted sequence are 2L:13221453..13222220 , release 6 genome and the 5' end of the deletion is within the start codon of Ski6). This results in a simultaneous knock-out of Ski6 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Ski6 (predicted to gene trap all annotated transcripts of the gene). The 5' end of the deletion associated with the insertion is 367 bp upstream of the 5' end of the CG16812 gene and may affect its transcription. The 3' end of the deletion associated with the insertion is 55 bp downstream of the 3' end of the mRF1 gene and may affect the proper 3' end formation of its transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CTAAAGTTTCAAAATATGTCTGG and ATTGTAAAAAACGACAAGATTGG.