A TI{KozakGAL4} DNA cassette has been inserted into Cdc5, replacing most of the coding sequence (coordinates of deleted sequence are 3L:358522..361162 , release 6 genome and the 3' end of the deletion is 25 bp upstream of the stop codon of the Cdc5 gene). This results in a simultaneous knock-out of Cdc5 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Cdc5 (predicted to gene trap all annotated transcripts of the gene). The 5' end of the deletion associated with the insertion is 310 bp upstream of the 5' end of the CG1233 gene and may affect its transcription. The 3' end of the deletion associated with the insertion is 36 bp downstream of the 3' end of the Roc1b gene and may affect the proper 3' end formation of its transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GCTTTCTGTCGCGTATACAATGG and CTGGTCGGGCAGGAGTTGCTGGG.