A TI{KozakGAL4} DNA cassette has been inserted into CG11975, replacing the coding sequence (coordinates of deleted sequence are 3R:8993353..8994783 , release 6 genome). This results in a simultaneous knock-out of CG11975 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG11975 (predicted to gene trap all annotated transcripts of the gene). The upstream end of the deletion associated with the insertion is 404 bp from the annotated TSS of the E(var)3-9 gene on the opposite strand and may affect its expression. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GATGCTGGAAGCCCGGGCTCTGG and TATACCTTGAGACATGATTGTGG.