A TI{CRIMIC.TG4.0} DNA cassette has been inserted into AsnRS-m, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of AsnRS-m downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target AsnRS-m : one targeted to a coding intron (ACAATTCGCACGTTTGAAAAGGG) and the other to a non-coding exon in the 3' UTR (GATCACATCTTGCAGCTGTGTGG). The 3' end of the deletion associated with the insertion extends to within 39 bp from the annotated 3' end of the NiPp1 gene and may affect its proper 3' end formation.