A TI{KozakGAL4} DNA cassette has been inserted into vnc, replacing the coding sequence (coordinates of deleted sequence are 3L:9973274..9973887 , release 6 genome). This results in a simultaneous knock-out of vnc plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of vnc (predicted to gene trap all annotated transcripts of the gene). The deletion also within the 3'UTR of CG42455 and is not predicted to gene trap this gene. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CGCAGCGGATGTTCATGGTGAGG and CTTTCGCTGCCGGCGCCTGCTGG.