Open Close
General Information
Interaction Type
Interacting Genes
FlyBase ID
FBig0000120421
Interaction Network
Interactions Browser links
mir-8 network
Vha55 network
esyN Network Diagram
Show neighbor-neighbor interactions:
Select Layout:
Legend:
Protein
RNA
Selected Interactor(s)
Common Interactor(s)
Reported Interactions
FBrf0245520-13.miR-mRNA.LUC
Reference
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

miR-8

bait

Vha55

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
3-prime UTR
sufficient binding region
mir-8 target site
mutation decreasing interaction
UUCACCAGUUCGCACAAGUAUUA to UUCACCAGUUCGCACAAGUCGAC
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Luciferase reporter assay.

Source was S2 cell line; bait produced from transfected construct; prey produced from transfected reporter construct.

FBrf0245520-18.miR-mRNA.PCR
Reference
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

miR-8

bait

Vha55

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Overexpression of mir-8 reduces Vha55 mRNA and protein levels.

Source was S2 cell line; bait produced from transfected construct; prey produced from endogenous gene.

FBrf0245520-21.miR-mRNA.WB
Reference
Description
physical association
Collection
Cell line used
Participants
Corresponds to
Reported as
Role
Note

miR-8

bait

Vha55

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was larvae of wild-type or mutant strain; bait produced from endogenous gene; prey produced from endogenous gene.

Mutation of mir-8 increases Vha55 protein levels.

External Crossreferences and Linkouts ( 0 )
References (1)