FB2026_01 , released March 12, 2026
FB2026_01 , released March 12, 2026
Reference Report
Open Close
Reference
Citation
Tomkiel, J. (2001.12.6). Df(2R)P803-delta15. 
FlyBase ID
FBrf0141808
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
The following information accompanied a stock donated to the Bloomington Stock Center by John Tomkiel, Wayne State U. (11/01).
Df(2R)P803-delta15 was recovered as transposase-mediated male recombination event in P{lacW}l(2)k08805k08805/cn1 bw1; delta2-3 fathers. The deletion chromosome carries cn1, and the deletion extends from the 3' end of P{lacW}. The P element-associated w+ eye color marker is still present as judged by phenotype, and the 5' and 3' ends of the P element are present and non-rearranged as determined by DNA sequencing. Sequencing of an inverse PCR product generated after MspI digestion of genomic DNA indicates that the P element is now adjacent to the sequence GGTTTAGCAATTATTACTTTATTT, which is within the coding sequence of the Ark gene at 53E.
The chromosome fails to complement the recessive lethality of the P{lacW}l(2)k08805k08805 parental chromosome, P{lacW}l(2)k15914k15914 and teflon.
DOI
Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference
    Aberrations (1)
    Alleles (4)
    Genes (3)
    Insertions (2)