The following information accompanied a stock donated to the Bloomington Stock Center by John Tomkiel, Wayne State U. (11/01).
Df(2R)P803-delta15 was recovered as transposase-mediated male recombination event in P{lacW}l(2)k08805k08805/cn1 bw1; delta2-3 fathers. The deletion chromosome carries cn1, and the deletion extends from the 3' end of P{lacW}. The P element-associated w+ eye color marker is still present as judged by phenotype, and the 5' and 3' ends of the P element are present and non-rearranged as determined by DNA sequencing. Sequencing of an inverse PCR product generated after MspI digestion of genomic DNA indicates that the P element is now adjacent to the sequence GGTTTAGCAATTATTACTTTATTT, which is within the coding sequence of the Ark gene at 53E.
The chromosome fails to complement the recessive lethality of the P{lacW}l(2)k08805k08805 parental chromosome, P{lacW}l(2)k15914k15914 and teflon.