The 20bp VAS4 DNA sequence (TAGAGTACCCGGGCTTGCCT) is an artificial sequence designed to be specifically and robustly bound by the TALE repeat present in the TALE4::VP64 driver. VAS4 and TALE4::VP64 thus form a binary expression system that can be used to control the spatial and temporal expression of a gene of interest: a transgene or modified endogenous locus carrying the target gene of interest downstream of VAS4 sequences is combined with a second transgene or modified endogenous locus encoding the TALE4::VP64 driver expressed in the required expression pattern (FBrf0237269).