Open Close
General Information
Symbol
Dmel\dsx-RB
Species
D. melanogaster
Annotation Symbol
CG11094-RB
FlyBase ID
FBtr0081760
Feature type
Associated gene
Evidence Rank
Length (nt)
3627
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 6 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TTTAAATTATGTTATTTTTAGCATGGTTTACTTATGGAAAAGAGCATAGTTAAGGGTTTACAATGAAAACGGTCAAATAA
          GGGTATCCATATCTGGTACCAAACCAATTTGCTTTCTCCCAGTTGATGTGCAGTGCATCCAGCAGTCGAGCAGGTTGGAT
          GCTCGCACTCGTTTCTTTTTTCGCGGTGCAGCAACCAGAGTGCAAATACAAATAGCAAGAGCGTTGCGTCGCCAGTCGGT
          GGGCCCGTCTCTGTGCCAGAAACACATGCTCAGTTTTAGGTCCGCCCGTCCGCCTGAATGTCCGTGTATCTGTCCGCTGT
          CTTTTGGTCTGCTAGTCGGACTGGTACTGGTCCGAGTGTTAGTATCGTGCACGGGGAGCTTTAGCTTTGTGGCCGCAACC
          AGTTTGCTGGCATCGATCGTCCTTTGCAGGTCGTGCATGTCGCGTTGGCGTCTCGCGCCGTCCGCGTTCCGTGCTCGAAA
          TCACAATCTCAAGCTGAAGTGAAAAGAACTGGAGCGGATTCGGTACAAAATTCTGTGCGATAGTTTTTAGTTGCTGTGCG
          AGGTCCGAAAATATCTCTAAAATGCGTTGACCTACAGGGAACCAGATCGAGCCGCGAGTGCCATGCTAAACAAAGTCGTT
          TGCGGCTACAGCTTGTACGGTTTAAGATAACAAATAAAAGAAATAAATTTTTACCGGCTTCACACTCTCACTCTCGGTCC
          ACGAAGCACTCCTGACCGTCTCGTACCCAGCCGATCGGACTCCCCGTATCTCATCGAGTTCGCCGAGTGCTAGTGCTATA
          TTCTCTCACTTTGCTTGCATAACCAAGAGCAAAGCACACCTCGCGGAGGCAGATCGCAGATGCAGATACAGATACATATA
          CTGCTAGTGGTCTAGTAGTGGACCTGGAGATACTCTAGCGAGTGCATGCAATTGGCATTGTACCTGGTGCTTCTAAAATC
          AAAAGAAAGCAGCAAAATTTAAAAGTGAGACCTAAAGTCGAAATATTTTCCAATACTCTTCGGACTTACCCAATAACTTA
          AGCTTACCAATAATTTATGCAAGACTAAATTGCAATAAAGGCATATAATCCCTAACAATATAACTCTCATTGAAAAAATC
          TTAAATAATTTAAACCCCAGTGAATTAAACAGCAAAAGACAGTTAATAGACACAGAAAATGCTAATAAAAATAGCATAAT
          AAAAGCACGGTTACATAAACTTAGACGCTCGAACATTTACATAGGATATCAGAAGCTGGAATCATGGTTTCGGAGGAGAA
          CTGGAATAGCGACACGATGTCCGACTCGGACATGATCGACTCAAAGAACGACGTCTGTGGCGGAGCCTCCAGTTCCAGCG
          GCAGCTCGATTTCGCCGAGGACACCACCGAACTGCGCCCGCTGCCGCAATCATGGCCTAAAGATCACCCTAAAGGGACAC
          AAGCGGTACTGCAAGTTCCGCTACTGCACGTGCGAGAAGTGCCGACTGACGGCGGACCGCCAGCGGGTGATGGCTCTGCA
          AACGGCCTTGAGGCGAGCCCAGGCGCAGGATGAGCAGCGGGCGCTGCACATGCACGAGGTGCCGCCTGCCAATCCGGCGG
          CCACGACCCTCCTGAGTCATCACCATCATGTCGCAGCTCCCGCTCATGTCCACGCCCACCATGTGCACGCCCATCACGCA
          CACGGAGGACACCACTCGCATCACGGACATGTCCTGCACCACCAGCAGGCAGCGGCGGCCGCAGCAGCAGCTCCGTCGGC
          TCCAGCCTCCCATCTGGGTGGCTCCAGCACGGCCGCTTCCAGCATCCACGGTCACGCCCACGCGCACCACGTCCACATGG
          CAGCTGCTGCAGCCGCCTCGGTGGCTCAGCACCAGCACCAAAGCCACCCACACTCGCACCACCACCACCACCAGAACCAC
          CACCAGCATCCGCATCAGCAACCGGCCACGCAGACCGCCCTGCGATCTCCGCCGCACAGCGACCATGGTGGCAGTGTGGG
          TCCGGCCACCAGCAGCTCCGGCGGTGGAGCACCCAGTTCCAGCAATGCGGCAGCGGCCACCTCGAGCAACGGATCCAGCG
          GCGGTGGAGGAGGAGGCGGAGGGGGCAGCTCGGGTGGCGGGGCAGGAGGTGGTAGGTCATCGGGAACATCGGTGATCACT
          AGCGCCGATCACCACATGACCACGGTGCCTACGCCCGCCCAATCGCTGGAGGGGTCCTGCGACTCGTCGTCGCCCTCGCC
          GTCGTCCACTTCCGGTGCAGCCATTTTGCCGATCTCAGTTTCCGTCAATCGAAAGAACGGCGCCAATGTGCCCTTGGGCC
          AAGACGTTTTCCTAGACTATTGCCAAAAGCTATTAGAAAAATTCCGCTATCCTTGGGAGCTGATGCCACTCATGTATGTG
          ATATTAAAGGACGCAGACGCCAACATTGAAGAGGCTTCCCGGCGAATCGAAGAGGGCCAATACGTTGTGAATGAGTACTC
          CCGTCAACATAATTTGAATATCTATGACGGGGGTGAGCTGCGCAACACAACGCGGCAATGTGGATGATAATTTTTCATTA
          ACTAGAGTAACGAATACTACTTTGCCCCGATATTTATTATTGTTCAGCATCACATATTAGCTTAATGCTTCGGTGAAATC
          GCGCGAATTTAACTTTTATAACTTAGAGTTGAGTAACTTAGAGTTTTATGGAGCAAAACCTCTGTAAATAAATCGAATTT
          ATCGGTAAACTAAAGCGCGACTTGGACTATCTTCAATCAACAAGCCAAATATGTCGATGTGTGACAGCCGTTCTACGCGT
          CAGCTTTCTTCAATCAACATTACCCCGTGCTGAGATGTCTGGCCTCAATGTTAATAATCTCAATCTACAATCAACATTCT
          CTTCTCTTCAATCAACAATCCGCAAACGGATCTAATCAACAATCAACATAGCCCTTGCCGCCAACGAATAATATAATCAA
          AGGACAAAGGACAAAATGTAGTAAACGTTTTTAAAAAATATTCGAAATACGCACGCCAAATCAACGATCAACATTTCAAC
          ACGTTCGCATCACAAATCTGCGCATCGGTTGTATAGCTTTAGTTTAACCTTATTTAAGTTTGGCATTACTCAGTTTATTG
          GGCTAATCACAGTCTAATTAAAGCCATTGAAAGCGCCTCACTTCAGTCATTTATGCTTTTATTGTTTACTTAAGTACTTA
          ACTGAATCTAAGTACAAAATAATGTTTCTTTCGTAAGCAGCACTAAATTGATCAACAAAGGGGATCGAGAAGAAAACTAG
          GATATACACACTCATTCGAATAGGCATACAAGCCAATCTCAAATTTCTTCTTTGCGTGTGAATTTGTATCTTAGCAAGGC
          AATTGCATAGTAACCCTTGAAGAAATGATAACTACTTTCCGGGGGTCTGGGTATCAAAACTGTTGTGAGATAGTGCACAA
          ATTATAAATATATTTAAGTTAGTGTTTCATCGATGTCTTGCGAAACTCTAATTGTAATATTGCATTACAACGAAAATTCT
          TATTGACATTGTAAAATATTGTTACGACCTTAAGTAAGATTTAGCCCAACGGAATATTATAAAAAGGATAAACCTGAAAT
          GTCAGAAATAAACTATTTTCCTTAAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0081759
          4010
          FBtr0081761
          3238
          FBtr0330073
          3621
          FBtr0330074
          4010
          FBtr0339710
          6941
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0081257
          427
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0081256
          549
          FBpp0081258
          427
          FBpp0303106
          549
          FBpp0303107
          572
          FBpp0308767
          427
          Comments

          Female-specific transcript (FBrf0049391).

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG11094-RB
          Secondary FlyBase IDs
            References (2)