3098bp deletion ( 3R:31794683..31797780 ) spanning from the P{EP}AcfEP1181 insertion site in the first Acf intron through to the third exon. Generated by imprecise excision of P{EP}AcfEP1181. 34bp (CATGATGAAATATCTGAAATATCAATGAAATGTC) of unknown origin is inserted into the site of the deletion.
Deletion of sequence encoding Acf amino acid residues 41-951.
A 3,089 bp deletion resulting from the imprecise excision of P{EP}AcfEP1181 that maps to 3R:31794683-31797780 . 34 bp of unidentified sequence (CATGATGAAATATCTGAAATATCAATGAAATGTC) is inserted at the site of the deletion.
Acf7/Acf7 mutant females display a significant reduction in egg laying. A subset of Acf7/Acf7 mutant ovarioles display degeneration of the most posterior egg chamber, as shown by increased apoptosis in both oocyte and nurse cells, but no chromatin or chromosome morphology defects are detected, as compared to wild type. Oogenesis appears normal in the germarium and in stages 3-6. Acf7/Acf7 mutant egg chambers do not exhibit packaging defects.
Acf7/Df(3R)BSC687 mutants display egg chamber apoptosis defects.
Expression of AcfC.T:Scer\TY1,T:Avic\GFP-EGFP,T:Zzzz\FLAG induces egg chamber cell packaging defects, including compound egg chambers, in Acf7/Acf7 mutants.
Acf7 is rescued by AcfTag:TY1,EGFP,Tag:FLAG
Acf7 is rescued by AcfN.Tag:TY1,EGFP,Tag:FLAG
Acf7 is not rescued by AcfC.Tag:TY1,EGFP,Tag:FLAG
Expression of AcfN.T:Scer\TY1,T:Avic\GFP-EGFP,T:Zzzz\FLAG or AcfT:Scer\TY1,T:Avic\GFP-EGFP,T:Zzzz\FLAG/AcfT:Scer\TY1,T:Avic\GFP-EGFP,T:Zzzz\FLAG, but not AcfC.T:Scer\TY1,T:Avic\GFP-EGFP,T:Zzzz\FLAG, rescues the apoptotic egg chamber phenotypes of Acf7/Acf7 mutants.