7 acidic residues within the first 34 amino acids of yki are mutated to alanines.
GCCAAGGCCATCGCCGCCGCCGCC
The region at the 5' end of yki encoding "EKEIDDED" was replaced with sequence encoding "AKAIAAAA".
abnormal size | larval stage (with ykiB5)
ykiAcidA homozygotes display smaller wing discs, smaller wings and smaller adult body, as compared to heterozygous controls. ykiAcidA/ykiB5 transheterozygous wing discs are smaller than in ykiAcidA heterozygotes and appear more bilaterally symmetrical along the anterior-posterior axis than control wing discs.
ykiAcidA/ykiB5 transheterozygous wing discs are smaller than in ykiAcidA heterozygotes and appear more bilaterally symmetrical along the anterior-posterior axis than control wing discs.