Insertion of a head-to-tail concatemer of TI{CRISPaint.T2A-GAL4} sequence into the 5' part of the wg coding sequence. The insertion is in sense orientation (T2A-GAL4 sequence within the inserted sequence cassette is in the same orientation as transcription of wg) and is in-frame with respect to the wg open reading frame (as expected, GAL4 expression is seen). An indel (45bp deletion, 21bp insertion) is associated with the site of the TI{CRISPaint.T2A-GAL4} insertion.
GGGGGTCGGGGGGTTACCACC
Insertion of a head-to-tail concatemer of TI{CRISPaint.T2A-GAL4} sequence into the 5' part of the wg coding sequence. The insertion is in sense orientation (T2A-Scer\GAL4 sequence within the inserted sequence cassette is in the same orientation as transcription of wg) and is in-frame with respect to the wg open reading frame. An indel (45bp deletion, 21bp insertion) is associated with the site of the TI{CRISPaint.T2A-GAL4} insertion.