Open Close
General Information
Symbol
Dmel\GMR57C10
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000165807
Collection
Associated gene
Genomic Location
Chromosome (arm)
3L
Sequence location

3L:1,637,051..1,637,875

Sequence Data
Length
Comments
Associated Information
Experimental Data
Progenitors
PCR template
Primer 1
atttcccaccccttggccatcggca
Primer 2
gttctagagggttgcgctctcagtg
Comments
Collection Information
Comments

evidence: Reporter construct (in vivo)

Stocks (10)
External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
GMR57C10
Secondary FlyBase IDs
    References (10)