Open Close
General Information
Symbol
P{srp.Hemo-GAL4}
FlyBase ID
FBtp0023390
Feature type
transgenic_transposable_element
Component Allele(s)
Also Known As
srp-Gal4, srpHemo-Gal4, srpHemoGAL4, serpentHemoGAL4, serpent-GAL4, srp.Hemo-GAL4, srp(hemo)Gal4, serpentGal4
Size
Expression Data
GAL4 reporter/driver
Associated insertion(s)
Molecular map
Description and Uses
Location-dependent role
Description
CV term
Qualifiers and info
Reference
transposon
Construct components
Component allele Scer\GAL4srp.Hemo
Product class / Tool use(s)
Regulatory region(s)
Description

Expression of a GAL4 driver is under the control of 2 genomic sequences from upstream of srp amplified with AGGGTACCCTACTGCTTCCCACTCTAAGACTTCCAGTTTTAGGCTACG (sense) and GGAATTCGGCAATGCCCCACCCCTTGGCTGGACGG (antisense) as well as CGCGGTACCCAGCGGGAGCAACAGGATCAAATGCAGCAGCG (sense) and CGCGGTACCTATGGGATCCGTGCTGGGGTAGTGCTCGTAGAGC (antisense).

Sequence Data
Sequence (FB)
Associated Sequence Data
DNA Sequence
Extent
Segments and Size
Total Size
Left end
Right end
 
Segments
Num
Orientation
Symbol
Reference
Features
CV term
Qualifiers and info
Reference
binary
component
Component Alleles
Expression Data
Reporter Expression
distribution deduced from reporter (Gal4 UAS)
Stage
Tissue/Position (including subcellular localization)
Reference
Additional Information
Statement
Reference

Drives expression in hemocytes and pericardial cells (nephrocytes) from embryonic stage 9 through all larval stages.

Scer\GAL4srp.Hemo drives expression in nephrocytes and hemocytes

Scer\GAL4srp.Hemo drives expression in all hemocytes and macrophages at all embryonic stages, as well as in the head mesoderm that gives rise to hemocytes beginning at embryonic stage 9.

 
Reporter construct used in assay
Progenitors and Descendants
progenitor(s)
descendant(s)
Comments
Stocks (1)
External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (26)
Reported As
Symbol Synonym
(srphemo)-Gal4
P{srp.Hemo-GAL4}
P{srp.Hemo-Gal4}
Serpent-Gal4
Serpent-hemocytes-Gal4
SerpentHemo-Gal4
SrpHemo-GAL4
SrpHemo-Gal4
serpent-GAL4
serpentHemoGAL4
serpentHemoGal4
srp hemo-GAL4
srp.Hemo-Gal4
srpHemo-GAL
Secondary FlyBase IDs
    References (46)