Open Close
General Information
Symbol
Scer\GAL4srp.Hemo
Species
S. cerevisiae
Name
FlyBase ID
FBal0197807
Feature type
allele
Associated gene
Associated Insertion(s)
Carried in Construct
Also Known As
srp-Gal4, srpHemo-Gal4, srpHemoGAL4, serpentHemoGAL4, serpent-GAL4, srp.Hemo-GAL4, srp(hemo)Gal4, serpentGal4
Allele class
Nature of the Allele
Allele class
Mutations Mapped to the Genome
 
Type
Location
Additional Notes
References
Associated Sequence Data
DNA sequence
Protein sequence
 
 
Progenitor genotype
Carried in construct
Cytology
Nature of the lesion
Statement
Reference

Expression of a GAL4 driver is under the control of 2 genomic sequences from upstream of srp amplified with AGGGTACCCTACTGCTTCCCACTCTAAGACTTCCAGTTTTAGGCTACG (sense) and GGAATTCGGCAATGCCCCACCCCTTGGCTGGACGG (antisense) as well as CGCGGTACCCAGCGGGAGCAACAGGATCAAATGCAGCAGCG (sense) and CGCGGTACCTATGGGATCCGTGCTGGGGTAGTGCTCGTAGAGC (antisense).

Allele components
Product class / Tool use(s)
Regulatory region(s)
Expression Data
Reporter Expression
distribution deduced from reporter (Gal4 UAS)
Stage
Tissue/Position (including subcellular localization)
Reference
Additional Information
Statement
Reference

Drives expression in hemocytes and pericardial cells (nephrocytes) from embryonic stage 9 through all larval stages.

Scer\GAL4srp.Hemo drives expression in nephrocytes and hemocytes

Scer\GAL4srp.Hemo drives expression in all hemocytes and macrophages at all embryonic stages, as well as in the head mesoderm that gives rise to hemocytes beginning at embryonic stage 9.

 
Reporter construct used in assay
Human Disease Associations
Disease Ontology (DO) Annotations
Models Based on Experimental Evidence ( 0 )
Disease
Evidence
References
Modifiers Based on Experimental Evidence ( 0 )
Disease
Interaction
References
Comments on Models/Modifiers Based on Experimental Evidence ( 0 )
 
Disease-implicated variant(s)
 
Phenotypic Data
Phenotypic Class
Phenotype Manifest In
Detailed Description
Statement
Reference
External Data
Interactions
Show genetic interaction network for Enhancers & Suppressors
Phenotypic Class
Suppressor of
Statement
Reference
Phenotype Manifest In
Additional Comments
Genetic Interactions
Statement
Reference
Xenogenetic Interactions
Statement
Reference
Complementation and Rescue Data
Images (0)
Mutant
Wild-type
Stocks (1)
Notes on Origin
Discoverer
External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Scer\GAL4srp.Hemo
Name Synonyms
Secondary FlyBase IDs
    References (45)