FlyBase Allele Report: Dmel\wg[UAS.wg+intergenic-1.pCFD6]

General Information

Symbol

Dmel\wg^{UAS.wg+intergenic-1.pCFD6}

Species

D. melanogaster

Name

FlyBase ID

FBal0405641

Feature type

allele

Associated gene

Dmel\wg

Associated Insertion(s)

Carried in Construct

P{UAS-wg+intergenic-1.pCFD6}

Key Links

Transgenic product class

sgRNA

(Ewen-Campen and Perrimon, 2024)

Mutagen

in vitro construct

Nature of the Allele

Transgenic product class

sgRNA

(Ewen-Campen and Perrimon, 2024)

Mutagen

in vitro construct

(Ewen-Campen and Perrimon, 2024)

Progenitor genotype

Carried in construct

P{UAS-wg+intergenic-1.pCFD6}

Cytology

Description

UAS regulatory sequences drive expression of 4 sgRNAs. Two target wg (GGGGCCGGGGCTCCATGTGGTGG and CGATCCACTCTACGTTGAGAAGG) and two (GCAGACAACTGTGATGGCTC and CAGGACTTTATCGCCCAGCA) target random intergenic sequence.

(Ewen-Campen and Perrimon, 2024)

Allele components

Component

Use(s)

Regulatory region(s)

UAS

binary expression system - regulatory region

Encoded product / tool

Mutations Mapped to the Genome

Curation Data

Type

Location

Additional Notes

References

Variant Molecular Consequences

Associated Sequence Data

DDBJ / EMBL / GenBank

DNA sequence

Protein sequence

UniProtKB/Swiss-Prot

UniProtKB/TrEMBL

Expression Data

Reporter Expression

Additional Information

Statement

Reference

Marker for

Reflects expression of

Reporter construct used in assay

Human Disease Associations

Disease Ontology (DO) Annotations

Models Based on Experimental Evidence ( 0 )

Disease

Evidence

References

Modifiers Based on Experimental Evidence ( 0 )

Disease

Interaction

References

Comments on Models/Modifiers Based on Experimental Evidence ( 0 )

Disease-implicated variant(s)

Phenotypic Data

Phenotypic Class

decreased size | adult stage, with Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2

(Ewen-Campen and Perrimon, 2024)

increased cell death | larval stage, with Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2

(Ewen-Campen and Perrimon, 2024)

visible | adult stage, with Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2

(Ewen-Campen and Perrimon, 2024)

Phenotype Manifest In

wing, with Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2

(Ewen-Campen and Perrimon, 2024)

wing disc posterior compartment | larval stage, with Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2

(Ewen-Campen and Perrimon, 2024)

Detailed Description

Statement

Reference

External Data

Linkouts

Interactions

Show genetic interaction network for Enhancers & Suppressors

Phenotypic Class

Suppressed by

Statement

Reference

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, suppressible by p53^H159N.UAS.Ex/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, suppressible by p53^JF02513/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, suppressible by Scer\GAL4^hh.PU/lok^GL00020

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, suppressible by E2f1^HMS01541, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, suppressible by Rbf^UAS.cDa, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, suppressible by CycA^GLV21059, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, suppressible by hid^GD1673/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, suppressible by Scer\GAL4^hh.PU/btl::Egfr^λ.UAS

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, suppressible by Scer\GAL4^hh.PU/yki^{S111A.S168A.S250A.UAS.Tag:V5}

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, suppressible by Scer\GAL4^hh.PU/grk^ΔTC.UAS

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, suppressible by Krn^s.UAS.cUa, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, suppressible by Scer\GAL4^hh.PU/vn^UAS.cSa

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, suppressible by rho^UAS.cdCa/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

NOT suppressed by

Statement

Reference

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/grp^HMS01573

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by tefu^GL00138/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/bsk^K53R.UAS

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/puc^UAS.cMa

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by hh^UAS.cHa.EGFP/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by dpp^UAS.cSa/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/upd1^UAS.cUa

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by N^ΔE.UAS, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/ci^HMC05801

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Stat92E^HMS00035/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Myc^HMS01538, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/tkv^{Q253D.UAS.cNb}

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by mei-41^GL00284/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Myc^{WT.UAS.Tag:HA}, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by N^HMS00001, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by grp^JF02588/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/skl^GD1530

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/grim^GD11287

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by rpr^HMC03419/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/rpr^KK103975

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/skl^JF03093

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has increased cell death | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/skl^KK111864

(Ewen-Campen and Perrimon, 2024)

Phenotype Manifest In

Suppressed by

Statement

Reference

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, suppressible by p53^H159N.UAS.Ex/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, suppressible by Scer\GAL4^hh.PU/lok^GL00020

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, suppressible by Rbf^UAS.cDa, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, suppressible by p53^JF02513/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, suppressible by E2f1^HMS01541, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, suppressible by CycA^GLV21059, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, suppressible by hid^GD1673/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, suppressible by Scer\GAL4^hh.PU/btl::Egfr^λ.UAS

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, suppressible by Scer\GAL4^hh.PU/yki^{S111A.S168A.S250A.UAS.Tag:V5}

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, suppressible by Krn^s.UAS.cUa, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, suppressible by Scer\GAL4^hh.PU/vn^UAS.cSa

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, suppressible by Scer\GAL4^hh.PU/grk^ΔTC.UAS

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, suppressible by rho^UAS.cdCa/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

NOT suppressed by

Statement

Reference

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/grp^HMS01573

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by grp^JF02588/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by tefu^GL00138/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by mei-41^GL00284/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/skl^GD1530

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/rpr^KK103975

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/grim^GD11287

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by rpr^HMC03419/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/skl^JF03093

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/skl^KK111864

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/bsk^K53R.UAS

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/puc^UAS.cMa

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by hh^UAS.cHa.EGFP/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/upd1^UAS.cUa

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by dpp^UAS.cSa/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by N^HMS00001, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/ci^HMC05801

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Myc^{WT.UAS.Tag:HA}, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Stat92E^HMS00035/Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Scer\GAL4^hh.PU/tkv^{Q253D.UAS.cNb}

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by Myc^HMS01538, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Scer\GAL4^hh.PU, Spyo\Cas9^UAS.P2, wg^{UAS.wg+intergenic-1.pCFD6} has wing disc posterior compartment | larval stage phenotype, non-suppressible by N^ΔE.UAS, Scer\GAL4^hh.PU

(Ewen-Campen and Perrimon, 2024)

Additional Comments

Genetic Interactions

Statement

Reference

Xenogenetic Interactions

Statement

Reference

Complementation and Rescue Data

Comments

Images (0)

Mutant

Wild-type

Stocks (0)

Notes on Origin

Discoverer

External Crossreferences and Linkouts ( 0 )

Synonyms and Secondary IDs (1)

Reported As

Symbol Synonym

wg^{UAS.wg+intergenic-1.pCFD6}

Name Synonyms

Secondary FlyBase IDs

References (1)

Report Sections

Open Close