FB2026_02 , released June 18, 2026
Allele: Dmel\bamΔ86
Open Close
General Information
Symbol
Dmel\bamΔ86
Species
D. melanogaster
Name
FlyBase ID
FBal0030551
Feature type
allele
Associated gene
Associated Insertion(s)
Carried in Construct
Also Known As
bam86, bamΔ86, Δ86
Key Links
Genomic Maps

Nature of the Allele
Progenitor genotype
Cytology
Description

Deletion of approximately 1.4kb that extends from 136bp upstream of the bam coding sequence to 1282bp within the coding sequence. The sequence CATGATGAAATAACATGTTATTATGTTATGTTATGTTATTTCATCATGTTATTTCATCATGTTAA is present at the site of the deletion.

Deletion of most of the coding sequence.

Near complete deletion of the bam coding sequence.

Coding region except the carboxy-most 6 residues deleted.

Mutations Mapped to the Genome
Curation Data
Type
Location
Additional Notes
References
Comment:

A 1418bp deletion in bam, extending from 136bp upstream of the coding sequence to 1,282 bp within the coding sequence. The sequence CATGATGAAATAACATGTTATTATGTTATGTTATGTTATTTCATCATGTTATTTCATCATGTTAA is present at the site of the deletion."

Inserted_sequence:

CATGATGAAATAACATGTTATTATGTTATGTTATGTTATTTCATCATGTTATTTCATCATGTTAA

Variant Molecular Consequences
Associated Sequence Data
DNA sequence
Protein sequence
 
Expression Data
Reporter Expression
Additional Information
Statement
Reference
 
Marker for
Reflects expression of
Reporter construct used in assay
Human Disease Associations
Disease Ontology (DO) Annotations
Models Based on Experimental Evidence ( 1 )
Disease
Evidence
References
Modifiers Based on Experimental Evidence ( 1 )
Disease
Interaction
References
model of  germ cell cancer
is ameliorated by Atg173F5
is ameliorated by Atg61
is ameliorated by Cdk23
is ameliorated by InR339
Comments on Models/Modifiers Based on Experimental Evidence ( 0 )
 
Disease-implicated variant(s)
 
Phenotypic Data
Phenotypic Class
Phenotype Manifest In
Detailed Description
Statement
Reference

bamΔ86 mutants form tumors in the germaria that accumulate undifferentiated germline stem cell-like cells.

bam1/bamΔ86 mutant testes contain large number of over-proliferating spermatogonia.

Clones of bamΔ86 mutant female germline stem cells fail to properly differentiate, causing the accumulation of spectrosome-containing cells throughout the germarium.

bamΔ59/bamΔ86 adult females are completely sterile display tumorigenic phenotype in ovaries ('bag of marbles' phenotype). The full female sterility is not improved upon Wolbachia pipientis infection.

The completely sterility of bamBG/bamΔ86 males is not improved upon Wolbachia pipientis infection.

Expression of bamhs.PO induced via heat shock in a bamΔ86/bamΔ86 background results in increased germline stem cell differentiation, as evidenced by a lack of germline stem cells 24 h after heat shock, and germaria exhibiting only fusome-containing cysts within the niche, and very few spectrosome-containing cells; however at 48 h after heat shock, a majority of germaria show some single spectrosome-containing cells.

Heterozygous bamΔ86 testes show a ~60% 'tumor' rate.

Homozygous germline clones in the ovary result in stem cell-like tumours in the anterior region of the germarium. In contrast to wild type, the tumorous cells do not show a decrease in nucleolar size as the distance from the stem cell niche increases.

In bamz3-2884/bamΔ86 mutant ovaries, the germaria and most of the egg chambers are filled with undifferentiated cystoblasts.

bamΔ86/+ germaria have an increased number of spectrosome-containing cells compared to wild type.

Approximately 27% of bamΔ86/+ spermatocyte cysts contain 32 cells with 2% containing 64 cells.

75% of fusomes are spherical in bamΔ86 ovaries, and the remaining 25% are short and cylindrical.

bam1/bamΔ86 mutant testes show large germline cysts containing 32 or more cells undergoing S-phase, some located far from the testis tip, indicating that more than the usual 4 rounds of transit amplification has occurred.

bamΔ86/+ males usually make the transition from mitotic proliferation to spermatocyte differentiation, but often this occurs late. 43% of germline cysts complete at least one extra round of transit amplification prior to differentiation.

40% of male germline cysts prematurely differentiate at the 8-cell stage in males carrying one copy of bamΔPEST in a bamΔ86/+ background. In these cases, the 8-cell cysts have large cells with typical spermatocyte morphology. Post-meiotic cysts are observed with 32 instead of 64 elongating spermatids.

Each bamz3-2884/bamΔ86 transheterozygous ovariole has a tumorous germarium with 0 or 1 normal egg chambers, in contrast to wild type ovarioles that have 7-10 egg chambers after the germarium.

In bamz3-2884/bamΔ86 ovarioles, the tumorous germaria and egg chambers contain many single germline stem cells.

bamz3-2884 ovarioles carry a tumourous germarium and no normal egg chambers.

bamΔ86/+ germaria show a signifiant increase in cystoblast number compared to controls.

Mutant germaria are tumorous, containing only undifferentiated germline stem cell-like single germ cells.

bamΔ86 germline stem cell (GSC) clones outcompete normal, wild type GSCs and occupy their niches within germaria; in addition, mutant cystoblasts can invade the niche occupied by wild type GSCs and assume GSC identity. This appears to happen by the mutant GSCs simply forcing out the neighbouring wild type GSCs, as neither apoptosis nor differentiation is induced.

bamΔ86 germline stem cells (GSCs) divide significantly faster than controls.

In bamΔ86 homozygous females, there is a substantial increase in the numbers of both escort stems cells and escort cells per germarium.

In bamΔ86 female mutants, the ovariole tip contains a "stem cell tumour", comprising hundreds of germline stem cells (GSCs). This is in sharp contrast to wild-type ovarioles, which contain only 2-3 GSCs. As with wild-type GSCs, bamΔ86 GSCs delay cytokinesis. However, bamΔ86 GSCs lack the associated cap cells seen in wild type. Additionally, the new fusome of bamΔ86 GSCs grows to the same size as the old fusome and does not stretch out into the "exclamation point" configuration characteristic of GSCs in contact with cap cells.

Mutant females have tumorous ovarioles containing 300-1000 undifferentiated germ cells.

bamΔ86 female germ cells fail to differentiate.

The cells of bamΔ86/bamΔ86 female germ-line cell clones do not contain round spectrosomes and do not form germline cysts.

bamΔ86 homozygous females have ovaries with 'stem cell tumors' consisting of large numbers of undifferentiated germ cells.

Homozygous germ line clones in the testis overproliferate as spermatogonia-like cells.

bamz3-2884/bamΔ86 females are weakly fertile with small ovaries containing mostly wild-type egg chambers. Many germaria lack morphologically distinct cysts. Egg chambers containing endoreduplicating nurse cells and having a monolayer of follicle cells surrounding each egg chamber are seen.

Homozygous ovarioles show a tumourous phenotype. No elongated spermatids are present in homozygous testes.

Fate and proliferation of somatic cyst and hub cells is not affected in mutants testes. Mutant testes are not sexually transformed. Mutant clones induced in the cysts of male testes produce cysts with many more than 16 small germ cells, each having the morphological features of amplifying germ cells. Germ cells accumulating in the testes have a mixed identity, simultaneously retaining some aspects of stem cell fate while expressing markers of amplifying spermatogonial and primary spermatogonial cell fates. Distribution of both fusome and ring canal components indicates many mutant germ cells within a cyst are interconnected as a result of incomplete cytokinesis during the divisions leading to overproliferation. Most germ cells within a cyst undergo S and M phases in near-synchrony.

Homozygous females in which bamhs.PO is expressed using heat shock begin to lay eggs within 7 days of heat shock. Some of these eggs hatch and produce viable, fertile adults. Rescued ovaries are smaller than wild-type and contain a mixture of normal and abnormal egg chambers. The females do not produce tumorous cysts once heat shocks are stopped.

Homozygotes exhibit tumorous egg chambers. bamΔ86 encR1 double mutants also exhibit tumorous egg chambers.

Nearly every cell in an adult ovary contains a fusome, most often the organelles are spherical and sometimes appeared as two spheres that are close enough to touch. These look like a dumbbell and are suspected to be a fusome that has passed through a ring canal to connect two cells. Whenever a ring canal connects cells a fusome fills the canals lumen. bamΔ86; hts1 ovaries are phenotypically indistinguishable from bamΔ86 ovaries.

External Data
Interactions
Show genetic interaction network for Enhancers & Suppressors
Phenotypic Class
Enhanced by
Statement
Reference
Suppressed by
NOT suppressed by
Enhancer of
Statement
Reference
Suppressor of
Statement
Reference
NOT Suppressor of
Statement
Reference

bamΔ86 is a non-suppressor of decreased cell number | oogenesis phenotype of pelo1

Other
Phenotype Manifest In
Enhanced by
Statement
Reference
NOT Enhanced by
Statement
Reference

Dsim\bambam.Venus, bamΔ86/bamΔ59 has ovary phenotype, non-enhanceable by bgcn[+]/bgcn1

Suppressed by
Statement
Reference

bamz3-2884/bamΔ86 has cystoblast | increased number phenotype, suppressible by CSN4[+]/CSN4N

bamz3-2884/bamΔ86 has cystoblast | increased number phenotype, suppressible by CSN4k08018/CSN4[+]

bamΔ86 has female germline cell phenotype, suppressible by udd1

bamΔ86 has spermatocyte phenotype, suppressible by howstru-3R-3

bamz3-2884/bamΔ86 has ovariole phenotype, suppressible by eIF-4a[+]/eIF4A1006

bamz3-2884/bamΔ86 has ovariole phenotype, suppressible by eIF-4a[+]/eIF4A1013

bamz3-2884/bamΔ86 has ovariole phenotype, suppressible by eIF-4a[+]/eIF4Ak01501

bamz3-2884/bamΔ86 has ovariole phenotype, suppressible by eIF-4a[+]/eIF4A02439

bamz3-2884/bamΔ86 has germarium phenotype, suppressible by eIF-4a[+]/eIF4A1006

bamz3-2884/bamΔ86 has germarium phenotype, suppressible by eIF-4a[+]/eIF4A1013

bamz3-2884/bamΔ86 has germarium phenotype, suppressible by eIF-4a[+]/eIF4Ak01501

bamz3-2884/bamΔ86 has germarium phenotype, suppressible by eIF-4a[+]/eIF4A02439

bamz3-2884/bamΔ86 has ovariole phenotype, suppressible by vas[+]/vasRJ36

bamz3-2884/bamΔ86 has ovariole phenotype, suppressible by eIF4E1S058911/eIF-4E[+]

bamΔ86 has female germline stem cell phenotype, suppressible by pelo1

NOT suppressed by
Statement
Reference

bamΔ86 has germarium phenotype, non-suppressible by eIF-4a[+]/eIF4A1006

bamΔ86 has germarium phenotype, non-suppressible by eIF-4a[+]/eIF4A1013

bamΔ86 has germarium phenotype, non-suppressible by eIF-4a[+]/eIF4Ak01501

bamΔ86 has germarium phenotype, non-suppressible by eIF-4a[+]/eIF4A02439

bamΔ86 has ovariole phenotype, non-suppressible by eIF-4a[+]/eIF4A1006

bamΔ86 has ovariole phenotype, non-suppressible by eIF-4a[+]/eIF4A1013

bamΔ86 has ovariole phenotype, non-suppressible by eIF-4a[+]/eIF4Ak01501

bamΔ86 has ovariole phenotype, non-suppressible by eIF-4a[+]/eIF4A02439

bamΔ86 has female germline stem cell phenotype, non-suppressible by pelo[+]/pelo1

bamΔ86 has testis | germline clone phenotype, non-suppressible by put135

Enhancer of
Statement
Reference

bam[+]/bamΔ86 is an enhancer of cystoblast | adult stage | increased number | temperature conditional phenotype of Crei\I-CreIhs.PR

bam[+]/bamΔ86 is an enhancer of testis phenotype of tut4

bam[+]/bamΔ86 is an enhancer of spermatogonium phenotype of tut4

bam[+]/bamΔ86 is an enhancer of ovary phenotype of mei-P261

Suppressor of
Statement
Reference

bam[+]/bamΔ86 is a suppressor of egg chamber phenotype of aurB1689

bam[+]/bamΔ86 is a suppressor of germline cell phenotype of aurB1689

bam[+]/bamΔ86 is a suppressor of ring canal phenotype of aurB1689

bam[+]/bamΔ86 is a suppressor of nurse cell phenotype of aurB1689

bam[+]/bamΔ86 is a suppressor of female germline cyst phenotype of aurB1689

bam[+]/bamΔ86 is a suppressor of female fusome phenotype of aurB1689

bamΔ86 is a suppressor of phenotype of CycAΔ.Tag:HA

Other
Statement
Reference
Additional Comments
Genetic Interactions
Statement
Reference

The reduced male fertility as well as morphological defects in the adult testes (including but not limited to hyperplastic cyst overgrowth) observed in adult males expressing CHES-1-likeScer\UAS.T:Ivir\HA1 under the control of either the Scer\GAL4nos.UTR.T:Hsim\VP16 or the Scer\GAL4bam.T:Hsim\VP16 driver are enhanced to a variable degree by combination with a single copy of bamΔ86.

Expression of dppJF01371 or ptcJF03223, but not ciGD1403, under the control of Scer\GAL4C587 in flies expressing bamhs.PO induced via heat shock in a bamΔ86/bamΔ86 background suppresses the recovery of spectrosome-containing cells at 48 h after heat shock seen in flies expressing bamhs.PO alone in a bamΔ86/bamΔ86 background.

Introducing bamΔ86/+ into the tut4 background blocks germline development at spermatogonial stage.

ball2 bamΔ86 double mutant germline cells in the ovary do not form tumours. The double mutant cells are lost from the stem cell niche, with the rate of stem cell loss being similar to that seen in ball2 single mutants. Double mutant germline cells that have been displaced from the niche do not differentiate into germline cysts and they eventually degenerate.

One copy of CSN4N dramatically suppresses the increase in the number of undifferentiated cystoblasts seen in bamz3-2884/bamΔ86 mutants, dramatically increasing the number of differentiated cysts containing a branched fusome and the number of normal egg chambers per ovariole.

One copy of CSN4k08018 dramatically suppresses the increase in the number of undifferentiated cystoblasts seen in bamz3-2884/bamΔ86 mutants, dramatically increasing the number of differentiated cysts containing a branched fusome and the number of normal egg chambers per ovariole.

Expression of CSN4Scer\UAS.P\T.T:Ivir\HA1 under the control of Scer\GAL4nos.PU in a bamΔ86/+ mutant background results in an increase in cystoblast and two cell cyst number in the ovary compared to controls. Germline stem cell number is unaffected.

One copy of CSN5N drastically and significantly enhances the differentiation defect of the bamΔ86/+ mutants. The number of cystoblasts and two cell pairs is significantly increased compared to either heterozygote alone.

One copy of CSN5N drastically enhances the differentiation defects seen in bamz3-2884/bamΔ86 mutant cystoblasts.

One copy of Nedd8AN015 drastically enhances the differentiation defects seen in bamz3-2884/bamΔ86 mutant cystoblasts.

udd1 partially suppresses the differentiation defects seen in bamΔ86 mutant female germline cells. Many four- and eight-cell cysts with branched fusomes and ring canals are seen, but mature 16 cell cysts are not observed.

The germarium phenotype of bamΔ86 Df(3R)Exel6198/twin41 bamΔ86 double mutant females is a mixture of a bam mutant phenotype (accumulation of germline stem cell (GSC)-like cells containing a spectrosome) and a twin mutant phenotype (lack of GSCs or lack of germ cells). The phenotype changes over time, with the percentage of bam mutant phenotype decreasing and the percentage of twin mutant phenotype increasing as the flies age. The double mutant GSCs are able to differentiate.

Removal of one copy of bam, through a bamΔ86/+ strongly suppresses the aurB1689 phenotype (from 17% to 4% of eight cell cysts), indicating that the phenotype is caused by the reduction of aurB activity in the cyst and not in the germline stem cell.

Pdcd41/Pdcd41, bamΔ86/+ germaria contain significantly more spectrosome-containing cells compared to either Pdcd41/Pdcd41 or bamΔ86/+ alone.

3 day old females expressing nosALL.T:Hsap\MYC in a bamΔ86/+ background show a modest but consistent increase in the average number of spectrosome-containing cells per germarium which is accompanied by a statistically significant loss of differentiated cysts. This effect is more pronounced in 20 day old females.

Expression of howL.Scer\UAS under the control of the weak driver Scer\GAL4nos.PG enhances the bamΔ86/+ phenotype, as shown by the fact that 65% of cysts containing 32 spermatocytes, compared to 27% in bamΔ86/+ single mutants.

A howstru-3R-3 heterozygous background results in the generation of 8-cell cysts of spermatocytes and suppresses the extra divisions present in bamΔ86/+ males.

The fusome phenotype of snf148 ; bamΔ86 double mutant ovaries is more similar to that of the snf148 single mutant phenotype than that of the bamΔ86 single mutant phenotype.

The delayed differentiation of 16-cell male germline cysts until they are greater than 32-cells/cyst in animals expressing stgScer\UAS.cNa under the control of Scer\GAL4bam.T:Hsim\VP16 is enhanced from 11% to 27% in a bamΔ86/+ mutant background.

The premature differentiation of 8-cell male germline cysts observed in animals expressing trblScer\UAS.P\T.cMa under the control of Scer\GAL4bam.T:Hsim\VP16 is suppressed, from 63% to 10%, in a bamΔ86/+ mutant background, and the frequency of 16-cell cysts is increased from 37% to 87%.

Most bamz3-2884/bamΔ86; eIF-4a/+ ovarioles contain 4-6 normal egg chambers, while the germaria contain fewer single germ cells compared to bamz3-2884/bamΔ86 ovarioles.

All of the eIF-4a alleles tested fail to dominantly suppress the tumourous phenotype of bamΔ86 ovarioles.

The vasRJ36 or eIF-4ES058911 allele dominantly suppresses the bamz3-2884/bamΔ86 ovariole phenotype.

Scer\GAL4nos.UTR.T:Hsim\VP16-driven expression of eIF-4aScer\UAS.P\T.T:Hsap\MYC in a bamΔ86/+ background results in significantly more cystoblasts in the germarium compared to bamΔ86/+.

bamΔ86 E2f107172 double mutant germline stem cell (GSC) clones are much less competitive than bamΔ86 single mutant GSCs.

bamΔ86 E2f1rM729 double mutant germline stem cell (GSC) clones are much less competitive than bamΔ86 single mutant GSCs.

bamΔ86 put10460 double mutant germline stem cell (GSC) clones retain a similar ability to bamΔ86 single mutant GSCs to outcompete wild type GSCs in the same niches.

bamΔ86 put135 double mutant germline stem cell (GSC) clones retain a similar ability to bamΔ86 single mutant GSCs to outcompete wild type GSCs in the same niches.

Approximately 80% of stwl95 bamΔ86 double mutant female germaria contain germ cells interconnected by branched fusomes, indicating that cystoblasts have formed and initiated cyst differentiation. On average, 30% of germ cells in these ovaries are in clusters penetrated by branched fusomes.

pum02003 bamΔ86/pum9 bamΔ86 double mutant ovaries have a complex phenotype that is distinct from that of either single mutant. A mixture of apparently undifferentiated cells and overtly polyploid cells is seen. In many cases, the polyploid chromosomes are thick and expanded like nurse cell chromosomes. Occasionally these pseudo-nurse cells are organised within an epithelial layer of follicle cells, like a cyst, although these cysts never contain a full complement of 16 cystocytes. These cysts contain ring canals.

piwi1 ; bamΔ86 double mutant ovarioles have mildly tumorous germaria filled with 50-300 undifferentiated germ cells with no apparent egg chamber development. fs(1)Yb72 ; bamΔ86 double mutant ovaries display the same phenotype as seen in bamΔ86 single mutants. Most germaria are devoid of germ cells in pum1 bamΔ86/pum9 bamΔ86 double mutant females.

In pelo1;bamΔ86 double mutant germaria, germ cells are able to differentiate as cystocytes can form. This is evidenced by branched fusomes, although the morphology of these fusomes is abnormal. However, some germ cells remain undifferentiated, as abnormally enlarged spectrosomes persist. Germ cell differentiation is not rescued when bamΔ86 homozygous mutants are pelo1/+; these germaria also show the rapid loss of GSCs observed in pelo1 germaria.

Clones of female germ cells doubly homozygous for bamΔ86 and Mad12 are identical in morphology to bamΔ86 single mutant germ cells, and do not form germline cysts.

The 'stem cell tumor' phenotype seen in the ovaries of bamΔ86 homozygous females is suppressed by zpgunspecified/zpgunspecified.

bamΔ86 ovarian tumor cells transplanted into the dorsal mesoderm of stage 11-12 embryos from oskunspecified mothers can repopulate the ovaries of the resulting adults, forming tumorous ovaries. The fertility of these flies can be rescued by heat shock if the transplanted cells carry bamhs.PO.

bamΔ86 put135 double mutant germ line clones in the testis behave as bamΔ86 single mutant clones and overproliferate as spermatogonia-like cells, suggesting that bam is epistatic to put.

bamΔ86 can dominantly suppress the 32 cell cyst phenotype seen in heatshocked CycAΔ.T:Ivir\HA1 flies, reducing the proportion seen five-fold.

bgcn1/+ ; bamz3-2884/bamΔ86 females show germ cell hyperplasia. None of the germ cells contain the polyploid DNA complement that is diagnostic of nurse cell formation. These females are sterile.

mei-P261/Y ; bamΔ86/+ males are completely sterile. Spermatid differentiation fails to progress in these males. mei-P261/mei-P261 ; bamΔ86/+ females show a severe decrease in fertility compared to mei-P261/mei-P261 females, due to an increase in the formation of ovarian tumours and other egg chamber defects. Recombination is also severely decreased in these females. mei-P261/+ ; bamΔ86/+ females have normal fertility.

bgcnQS2; bamΔ86 double mutant germ cells also are interconnected and undergo S phase in synchrony. The double mutant germ cells, just like germ cells in either single mutant behave as amplifying primary or secondary spermatogonial cells, and not as stem cells, indicating that bam and bgcn are not partially redundant with each other.

Xenogenetic Interactions
Statement
Reference

Crei\I-CreIhs.PR germaria in which DNA damage has been evoked by heat-shock accumulate cystoblast-like single cells and this accumulation is strongly enhanced by bamΔ86 heterozygosity.

Expression of Dsim\bambam.T:Avic\GFP-YFP.Venus restores fertility of the otherwise sterile bamBG/bamΔ86 males (even under sperm exhaustion conditions).

Expression of Dsim\bambam.T:Avic\GFP-YFP.Venus partially restores fertility of the otherwise sterile bamΔ59/bamΔ86 females. The ovaries of the rescue females show multiple morphological defects that accumulate with age (loss of germline stem cells, improper number of cyst divisions, mitotic synchrony defects). However, when two copies of the Dsim\bambam.T:Avic\GFP-YFP.Venus transgene are used, the fertility of the rescue females is reduced (compared to one copy rescue) and they become virtually sterile by day 15. They also show accelerated loss of the germline stem cells from the ovaries and often lack them or any germline cells altogether. These effects are alleviated even by a single copy of endogenous wild-type bam. The partial fertility of bamΔ59/bamΔ86;Dsim\bambam.T:Avic\GFP-YFP.Venus xenogenetic rescue flies is also improved by Wolbachia pipientis infection.

The ovarian defects observed in bamΔ59/bamΔ86;Dsim\bambam.T:Avic\GFP-YFP.Venus xenogenetic rescue females cannot be exacerbated by combination with a single copy of bgcn1.

Complementation and Rescue Data
Fails to complement
Partially rescued by
Not rescued by
Comments

Expression of bam4.1.T:Avic\GFP-YFP.Venus restores fertility of the otherwise sterile bamΔ59/bamΔ86 females and bamBG/bamΔ86 males, although under sperm exhaustion conditions the rescue is not complete. Ovaries of the rescue females have wild-type morphology.

The fertility of bamΔ59/bamΔ86;bam4.1.T:Avic\GFP-YFP.Venus rescue flies is neither increased nor diminished by Wolbachia pipientis infection.

Images (0)
Mutant
Wild-type
Stocks (2)
Notes on Origin
Discoverer

D. McKearin.

Comments
Comments

Distribution of Sxl product in ovaries is abnormal, the transtition from cytoplasmic to nuclear distribution does not occur. Most if not all of the small germ cells that populate the tumorous cysts show high levels of Sxl protein. Small amount of male specific Sxl splicing can be detected in the ovaries but the level of Sxl protein is not affected.

External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (11)
Reported As
Symbol Synonym
bamΔ86
(Matsui et al., 2026, Harris et al., 2025, Kai et al., 2025, Chavan et al., 2024, Huang et al., 2024, Rojas-Ríos et al., 2024, Zhang et al., 2024, Zhang et al., 2024, Baker et al., 2023, Gui et al., 2023, Monteiro et al., 2023, Wenzel and Aquadro, 2023, Wenzel and Aquadro, 2023, Zhang et al., 2023, Berry et al., 2022, Ilyin et al., 2022, Kitzman et al., 2022, Lim et al., 2022, Mathieu et al., 2022, Chen et al., 2021, Kahney et al., 2021, Yu et al., 2021, DeLuca et al., 2020, Ji et al., 2019, Primus et al., 2019, Wooten et al., 2019, Flora et al., 2018, Maksimov et al., 2018, Zhao et al., 2018, Kim et al., 2017, Ma et al., 2017, Shan et al., 2017, Carreira-Rosario et al., 2016, Li et al., 2016, Ma et al., 2016, Sanchez et al., 2016, Dolezal et al., 2015, Flores et al., 2015, Fu et al., 2015, Kao et al., 2015, Liu et al., 2015, Luo et al., 2015, Sieber and Spradling, 2015, Sun et al., 2015, Chen et al., 2014, Herzig et al., 2014, Maimon et al., 2014, Pan et al., 2014, Tseng et al., 2014, Zhang et al., 2014, Barton et al., 2013, Eikenes et al., 2013, Eun et al., 2013, Joly et al., 2013, Li et al., 2013, Mathieu et al., 2013, Cash and Andrews, 2012, Chau et al., 2012, Insco et al., 2012, Eliazer et al., 2011, Kirilly et al., 2011, Pek and Kai, 2011, Zhou et al., 2011, Gan et al., 2010, Monk et al., 2010, Tastan et al., 2010, Chau et al., 2009, Insco et al., 2009, Insco et al., 2009, Iovino et al., 2009, Li et al., 2009, Rhiner et al., 2009, Shen et al., 2009, Jiang et al., 2008, Jin et al., 2008, Neumuller et al., 2008, Maines et al., 2007, Roper, 2007, Mikhaylova et al., 2006, Niki et al., 2006)
Name Synonyms
Secondary FlyBase IDs
    References (125)